resolvase वाक्य
उदाहरण वाक्य
मोबाइल
- The SLX1-SLX4 complex acts as a Holliday junction resolvase.
- This pathway includes the Mus81 resolvase and the Sgs1 helicase.
- RuvC is the resolvase, which cleaves the Holliday junction.
- The CX3 complex associates with Holliday junction resolvase activity, probably in a role of stabilizing gene conversion tracts.
- The CX3 complex was shown to associate with Holliday junction resolvase activity, probably in a role of stabilizing gene conversion tracts.
- Hyperactive resolvase mutants, if further developed, could become an alternative to FLP, the most commonly used recombination systems in molecular biology to date.
- RHAU exhibits a unique ATP-dependent guanine-quadruplex ( G4 ) resolvase activity and specificity for its substrate " in vitro ".
- The functions of several of these proteins is known : these include the terminase, endonuclease, exonuclease, resolvase, helicase, primase and single-stranded binding protein.
- The converse examples are PhiC31 and related SRs, which were originally introduced as resolvase / invertases although, in the absence of auxiliary factors, integration is their only function.
- The entire resolvase recombination reaction can be reproduced " in vitro ", requiring only resolvase, a substrate DNA and multivalent cations, using either wild type protein or hyperactive mutants.
- The entire resolvase recombination reaction can be reproduced " in vitro ", requiring only resolvase, a substrate DNA and multivalent cations, using either wild type protein or hyperactive mutants.
- Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase and DNA replication.
- The MUS81-MMS4 endonuclease, although a minor resolvase for CO formation in " S . cerevisiae ", is crucial for limiting chromosome entanglements by suppressing multiple consecutive recombination events from initiating from the same DSB.
- The now classical members gamma-delta and Tn3 resolvase, but also new additions like ?C31-, Bxb1-, and R4 integrases, cut all four DNA strands simultaneously at points that are staggered by 2bp ( Fig . 2 ).
- During cleavage, a protein-DNA bond is formed via a transesterification reaction in which a phosphodiester bond is replaced by a phosphoserine bond between a 5 phosphate at the cleavage site and the hydroxyl group of the conserved serine residue ( S10 in resolvase ).
resolvase sentences in Hindi. What are the example sentences for resolvase? resolvase English meaning, translation, pronunciation, synonyms and example sentences are provided by Hindlish.com.